-
Categories
-
Pharmaceutical Intermediates
-
Active Pharmaceutical Ingredients
-
Food Additives
- Industrial Coatings
- Agrochemicals
- Dyes and Pigments
- Surfactant
- Flavors and Fragrances
- Chemical Reagents
- Catalyst and Auxiliary
- Natural Products
- Inorganic Chemistry
-
Organic Chemistry
-
Biochemical Engineering
- Analytical Chemistry
- Cosmetic Ingredient
-
Pharmaceutical Intermediates
Promotion
ECHEMI Mall
Wholesale
Weekly Price
Exhibition
News
-
Trade Service
Fudan, Chinese Academy of Sciences, Zhongshan Medical, Beijing Medical University students chemical test questions (questions are somewhat old, but very useful, apply for points!!) XIEXIE)
Sample TextSample TextSample Text
Biochemistry
Questions
Fudan University School of Medicine Master's Biochemistry (2001)
1, Noun Interpretation
1, DNA and CDNA2, Bright AA zipper 3, restrictive endoenzyme 4, Pasteur effect 5, peptide unit
6, Ribozyme7, ketone body 8, binding bile acid 9, inclusion and exon 10, oxidizing phosphate
2, question
1, insulin to reduce blood sugar mechanism. 2, the source of blood ammonia and the way. 3, test the processing of the pre-RNA of the urn.
4, an example of how E. coli can induce super-verticals to work? 5. What is a genetic code? What's the feature?
(2001)
1, Noun Interpretation
1, domin2, Gene Family 3, Kiyuan 4,
PCR
5, Cancer Gene 6, Estease
7, ATP Synthase 8, Bohr effect 9, LCAT10, second messenger 11, phosphate oxide 12, exon
13, reverse transcription 14, restrictive nucleic acid intrachea
2, question
1, test
antibody
diversity mechanism.
2, try to describe the cycle of the nuclear glycosome and its processes, and
the
of the protein is located?
3, how is the activity of enzymes regulated?
4, try to describe the mechanism of adrenaline regulation in sugar metabolism.
5, HDL and atherosclerosis.
6, try to describe the characteristics of the host as a prosury carrier.
7, there is a paragraph of mRNA as follows: - GCGAUGACCUUCCUAACUUU -
(1) indicates the initiater; (2) can UAA terminate transcription?
Biochemistry Question (2003)
1, Noun Explanation
1, Protein and Other Electron Points 2, Km3, Enzyme Competitive Inhibition 4, Sugar Enzyme 5, Pasteur Effect
6, SOD7, Lipoprotein 8, γ-Glutamine Base circulation 9, reverse transcription 10, genetic engineering 11, containing sub
12, shun action element 13, NF-kB14, anti-cancer gene 15, PCR
2, question
1, please write the reaction process of tricelic acid circulation, including reactants, products and total reactions.
2, fatty acids β-oxidation process and the role of acetylCoA.
3, the relationship between PNO structure and function, and to illustrate the structural basis of the mutation effect of enzymes
4, write dna replication enzymes and basic processes
5, the main ways of gene expression regulation of primary nuclear organisms.
6, an example of the subject type tyrosine egg quasi-cysts?
chinese Academy of Sciences 2001 bio - chemical B volume
one. Yes or no. (1X10)
1. The a carbon atom in all a amino acids is an asymmetric carbon atom. ()
2. The four-stage structure of a protein can be defined as a combination of a large molecular system formed by co-price bonds in the peptide chain of a specific three-stage structure. ()
principle of gel filtration layering, substances with a smaller molecular weight are the first to be washed away because they pass more easily.
4. Two or more secondary structural units are connected
peptides
together to form a local spatial structure with a special geometric arrangement, called a super-secondary structure, known as a module (MOTIF). ( )
5. Inhibitors do not bind to the substrate competitive enzyme, they do not show competitive inhibition. ( )
6. The most suitable PH for enzyme reaction depends not only on the dissocation of enzyme molecules, but also on the dissocation of substrate molecules. ( )
7. Oligosins generally refer to enzyme molecules consisting of multiple identical sub-base.( )
8. The glycolytic pathway is reversed by the same batch of enzyme-catalyzed glycolysis pathways.
9. The process by which the mitochondrial membrane ADP-ATP vector protein promotes ADP from the cytokine to the complete mitochondrial substation, while at the same time at the same time at the same time at the same time, the ATP from the complete mitochondrial substation to the cytokine requires energy. ( )
10. The diameter of the liposome can be as small as 150 nm. ( )
11. The glycoprotein base on the membrane is located on the outside of the membrane. ( )
12. Male
hormone
become estrogen in the body. ( )
coenzymes such as CoA, NAD and FAD all contain adenosine parts. ( )
14. The substrate of the jaundice oxidase is jaundice, or jaundice. ( )
15. The catalytic connection reactions of RNA and DNA connective enzymes require templates. ( )
16. The catalytic reactions of DNA polymerases and RNA polymerases require quotations. ( )
17. Etonal organisms contain 3'-OH. at both ends of m RNA. ( )
18. The synthesis of RNA polymerases and RNA glycosome proteins in bacteria is made up of a common regulatory system. ( )
19. The role of all ammonia-t RNA synthases is to connect amino acids to the 3'-hydroxyl of the nuclear sugar at the end of Trna. ( )
20. The core histoproteins in the nucleosome are not chemically modified during cell activity. ( )
ii. Choice question (1x25)
1. Fluffy membrane-promoting hormone is a kind of
A. steroloid hormone B. Fatty acid derivative hormone C. Nitrogen-containing hormone
2, cyanide bromide (CNBr) acting on the role of
methane-XB. X-tryptophan D. X-histamine
3. The active molecule of the myoglobin molecule having the following enzymes,
A. ATP Enzyme B. Protein Kinase C. Proteolytic Enzymes
4. Nerves
Growth Factor
(NGF) active molecules consist of the following peptide chains ________A. Alpha-B. beta-C. alpha-2 beta-2 beta-2
5. Insulinogen is a "connecting peptide" that connects the C and N ends of the other two chains through alkaline amino acid residues, a "connecting peptide" called _________A. A-chain B. B-chain C. The
constant corresponding to the total axis intercept of the two-to-several graph of the C-peptide is the
A. KmB. Vmax C. Km/Vmax D. Vmax/Km
7. Phosphatase kinase catalytics phosphatation of phosphatase, resulting in the change of the enzyme from a low-activity form
to a highly active form B. Activity is not affected
8. After the introduction of a substrate, the enzyme-substrate binding can be increased, at this time the enzyme catalytic reaction speed is increased, due to the
increased binding of B. binding can be used to reduce the reaction activated energy
The increased binding of C. can be used to reduce km D. The increased binding can be used to increase the activity of km
9.TGF beta-beta-
. Tyrosine kinase B. Tyrosine phosphatase C. serine/suline kinase D. Adenosine cyclase
10.2000 Nobel Prize in Physiology or Medicine has made significant contributions to which of the following areas
: Structural Physiology B. Developmental Physiology C. Neurobiology D. Immunology
11. Heron pliers are inhibitors at the point of their operation in
the mitochondrial ADP-ATP vector
C. Protein kinase CD. Mitochondrial respiratory chain reduction coenzyme Q-cell pigment c redoxase
12. Membrane intrinsic protein and membrane lipid interaction mainly through the
interaction of the ion bond B. hydrophobic bond C. hydrogen bond D. Van der Waal's force
13. The basic structure of the biofilm is that the two sides of the
phospholipid double layer are attached to different protein b. phospholipid formation layer structure, the protein is located between the layers
C. Proteins are skeletons, two layers of forest lipids are attached to the two sides of the protein
D. Phospholipid double layers are skeletons, proteins are attached to the surface or inserted into the phospholipid double layers
14. Coenzyme Q is
the co-base B. co-vector of NADH dehydrogenase
. Coenzyme
15.Complete mitochondrial transmetrics in state 4 can reach __A. 1mv B. 10mv C. 100mv D. 200 mv
16. The gene has two chains, the same chain as the mRNA sequence (T instead of U) called the chain
A. The chain B. the chain C. Heavy chain D. cDNA chain
17. A piece of oligonucleotide TψCGm1Acmm5CC, which contains several modified bases (non-modified nucleotides):
A. 3 B. 4C. 5D. 6
18. Known endocrine RNA, which is ___________A nucleotymeal RNA (sn RNA) B. Nuclear Uneconentional RNA (hnRNA)
19.Beluene alcohol can be used to treat gluconism because it is an inhibitor of
ostrich deaminase, reducing the production of uric acid B. Jaundice oxidase inhibitors and reducing urinary urine The production of acid C. Uric acid oxidase activator, accelerate the degradation of uric acid
20.α- Goose paste oxycodes can strongly inhibit the bacteria
RNA polymerase B.
C. Bacterial DNA polymerase D. Eugenic DNA polymerase
21. What is the relationship between each step of protein synthesis on the ucose, except for the peptide chain formation itself?
A. ATP Hydrolysing B. Hydrolysed C. GTP. Camp's hydrolysed D. Niacinamide nucleotides are involved in
22. Gene recombination is between DNA molecules:
A. Co-priced connection B. Hydrogen bond connection C. Ion bond connection
23. The unziping of double strands in the DNA replication process depends mainly on what
A. lead synthase B. Dnase IC. Restrictive endoenzyme D. Topological isomerase
24. What has been the progress of the Human Genome Project, which involves scientists from many countries, including China?
A. Only 23 pairs of chromosomes were completed for genetic and physical
. B. Only the nucleotide sequence of chromosome 7,10 and chromosome 22
C. The full sequence of the human genome 3X10-9 base was determined, but it was only a "book of heaven" that could not know its
full meaning
D. the whole sequence of the human genome was determined, the genetic information they represented was analyzed, and the function of most genes was understood
Panacid C. niacinamide D. thiamine
three fill in the blanks (one point per empty)
1. The single-stranded peptide that insulin was originally synthesized is called a prelude to insulin, called an insulin prelude.
The secondary structure of the collagen molecule is a three-wave helix, which is a structure in which each share is a special structure.
3. There is a class of irreversible inhibitors that have the properties of being activated by enzymes, called irreversible inhibitors, or enzymes,
. 4. "Proteomics" means that
the single activation factor of protease A is Camp, the single activation factor of protein kinase C is
6. The membrane intrinsic proteins of the three-dimensional structure of atomic resolution have been clarified to have , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , ,
, , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , The subject of a cholera toxin is a sub-base of the F1 part of the F1 enzyme of the F1F0 enzyme in which membrane catalytic oxidation phosphate is synthesized into ATP in mitochondria
8.