The Institute of Yellow Sea Fisheries, Chinese Academy of Fishery Sciences, "Primers, Methods and Kits for Identification of Masson Tuna Based on SNP Molecular Markers" was authorized by the National Invention Patent

Recently, the "primers, methods and kits for identifying masu tuna based on SNP molecular markers" researched and invented by Wang Lianzhu of the Yellow Sea Fisheries Research Institute of the Chinese Academy of Fishery Sciences has been authorized by the national invention patent, patent number: ZL 2020113958404
.

 

The present invention is based on 2b-RAD simplified genome sequencing end, mining the species-specific SNP site of bluefin tuna, providing a set of primers based on SNP molecular marker identification of masu tuna, comprising a pair of PCR amplification primers and a probe
designed based on the species-specific SNP molecular marker of masu tuna 。 The SNP molecular marker comprises a C base located at position 255 in the SEQ column, a sequence of the upstream primers in a pair of PCR amplification primers is or contains 5'? CCACAACCTCTGAGTCTGAACCT?3', the sequence of downstream primers is or contains 5'? GCAAAGGCTGATAGTAAACAACAAAT?3', the probe is in sequence 5'? TTTCATTCTGCCACTGTG?3' ordinary probe or sequence 5'? Cyclic probes of cattctg(C)ca?3' are labeled with fluorescent reporter groups at the 5' end of the probe and fluorescent quenching groups
at the 3' end.
The present invention can quickly identify or identify the masu tuna, having simple operation, low sampling amount, short detection cycle, good method specificity, high sensitivity characteristics
.