-
Categories
-
Pharmaceutical Intermediates
-
Active Pharmaceutical Ingredients
-
Food Additives
- Industrial Coatings
- Agrochemicals
- Dyes and Pigments
- Surfactant
- Flavors and Fragrances
- Chemical Reagents
- Catalyst and Auxiliary
- Natural Products
- Inorganic Chemistry
-
Organic Chemistry
-
Biochemical Engineering
- Analytical Chemistry
-
Cosmetic Ingredient
- Water Treatment Chemical
-
Pharmaceutical Intermediates
Promotion
ECHEMI Mall
Wholesale
Weekly Price
Exhibition
News
-
Trade Service
Medical Network, August 24 NewsOn August 23, the State Food and Drug Administration issued an announcement on two supplementary inspection methods including the supplementary inspection methods for rice-derived ingredients in water pills such as Huanglian Shangqing Pills (No.
101 of 2021)
.
101 of 2021)
.
The content of the announcement shows: According to the relevant provisions of the " Drug Administration Law of the People's Republic of China " and its implementation regulations, "Huanglian Shangqing Pills (Water Pills), Longdan Xiegan Pills (Water Pills), Fangfeng Tongsheng Pills (Water Pills) and Fenghan Cough Cough Pills ( Supplementary Inspection Method for Inspection Items of Rice-derived Ingredients in Water Pills" "Supplementary Inspection Method for Inspection Items of Aristolochic Acid I in Longdan Xiegan Pills" has been approved by the State Drug Administration and is hereby issued
.
.
Attachment: Supplementary inspection methods for inspection items
[Check] Rice-derived ingredients
Sample preparation Test sample preparation Take an appropriate amount of the test product, crush it, weigh out 10 g, add 50 ml of TE buffer solution (pH 8.
0) (10mmol/L Tris-HCl, 1mmol/L EDTA) preheated at 65°C, water bath at 65°C Shake to completely disperse, immediately pipet 0.
5ml of suspension into a 2ml centrifuge tube to get it
.
0) (10mmol/L Tris-HCl, 1mmol/L EDTA) preheated at 65°C, water bath at 65°C Shake to completely disperse, immediately pipet 0.
5ml of suspension into a 2ml centrifuge tube to get it
.
Standard material sample preparation Take 1 rice-derived DNA detection standard material, and dissolve it in 100 μl sterile ultrapure water to obtain it
.
.
Preparation of blank control sample Take 0.
5 ml of sterile TE buffer solution into a 2 ml centrifuge tube, and get it
.
5 ml of sterile TE buffer solution into a 2 ml centrifuge tube, and get it
.
Template DNA extraction Take the above-mentioned samples, and extract them with a plant genomic DNA extraction kit (spin column type) to obtain a template DNA solution, which is stored at -20°C for later use
.
.
PCR reaction identification primers: 5'TTAGCCTCCCGCTGCAGA3' and 5'AGAGTCCACAAGTGCTCCCG3'
.
PCR reaction system: carried out in a 200μl centrifuge tube, the total reaction volume is 25μl, the reaction system contains 2×PCR master mix (including DNA polymerase, dNTPs, MgCl2, reaction buffer, etc.
) 12.
5μl, identification primers (50μmol/L) 0.
2μl each, 2μl template DNA (or rice-derived DNA detection standard substance) solution, 10.
1μl sterile ultrapure water
.
Set 2 parallels for each sample
.
PCR reaction parameters: 95°C pre-denaturation for 3 minutes, 40 cycles of reaction (95°C for 30 seconds, 62°C for 30 seconds, 72°C for 30 seconds), 72°C extension for 10 minutes, and 4°C to store the reaction product
.
.
PCR reaction system: carried out in a 200μl centrifuge tube, the total reaction volume is 25μl, the reaction system contains 2×PCR master mix (including DNA polymerase, dNTPs, MgCl2, reaction buffer, etc.
) 12.
5μl, identification primers (50μmol/L) 0.
2μl each, 2μl template DNA (or rice-derived DNA detection standard substance) solution, 10.
1μl sterile ultrapure water
.
Set 2 parallels for each sample
.
PCR reaction parameters: 95°C pre-denaturation for 3 minutes, 40 cycles of reaction (95°C for 30 seconds, 62°C for 30 seconds, 72°C for 30 seconds), 72°C extension for 10 minutes, and 4°C to store the reaction product
.
Electrophoresis detection according to agarose gel electrophoresis method ("Chinese Pharmacopoeia" 2020 edition general rules 0541), the gel concentration is 2.
0%, the gel is added with the nucleic acid gel stain GelRed; test product, rice-derived DNA detection standard material and blank control The loading volume of the solution is 10-20μl, and the DNA molecular weight marker (DL500 is recommended) is 5μl
.
After the electrophoresis is over, take the gel piece and inspect it on the gel imager
.
0%, the gel is added with the nucleic acid gel stain GelRed; test product, rice-derived DNA detection standard material and blank control The loading volume of the solution is 10-20μl, and the DNA molecular weight marker (DL500 is recommended) is 5μl
.
After the electrophoresis is over, take the gel piece and inspect it on the gel imager
.
System applicability (1) Blank control should have no bands detected in the gel electrophoresis pattern ; (2) Rice-derived DNA detection standard materials should have bands detected in the gel electrophoresis pattern 50-100bp
.
The above two conditions should be met at the same time, otherwise the experiment will be invalid
.
.
The above two conditions should be met at the same time, otherwise the experiment will be invalid
.
For cloning and sequencing, commercial PCR product cloning kits were used to clone the PCR characteristic bands onto the T vector, use the Sanger method for sequence determination, and compare and analyze with the rice reference sequence
.
.
The result determined that in the gel electrophoresis pattern, the test product should not have a band the same size as the rice-derived DNA detection standard substance between 50 and 100 bp
.
If the corresponding band appears, the clone and sequencing result should be inconsistent with the given rice reference sequence
.
If there are individual base differences, compare the cloned sequencing results with other rice sequences in the NCBI database, and they should not match 100%
.
.
If the corresponding band appears, the clone and sequencing result should be inconsistent with the given rice reference sequence
.
If there are individual base differences, compare the cloned sequencing results with other rice sequences in the NCBI database, and they should not match 100%
.
Rice reference sequence
AGAGTCCACAAGTGCTCCCGCGCGTCC GAAGAAACCAACCACACTGCCGCTCTGCAGCGGGAGGCTAA
.
.
Remarks This method should be disposable containers or supplies, and washed thoroughly with high pressure sterilization and eliminates nucleic acid contamination of supplies, or can not be reused
.
The reagents are all analytical reagents or biochemical reagents, and the experimental water should meet the requirements of GB/T6682
.
All reagents are packed in containers that are not contaminated by DNase
.
.
The reagents are all analytical reagents or biochemical reagents, and the experimental water should meet the requirements of GB/T6682
.
All reagents are packed in containers that are not contaminated by DNase
.
Drafting unit: China Food and Drug Control Research Institute
Review unit: Sichuan Institute of Food and Drug Inspection
Medical Network, August 24 News On August 23, the State Food and Drug Administration issued an announcement on two supplementary inspection methods including the supplementary inspection methods for rice-derived ingredients in water pills such as Huanglian Shangqing Pills (No.
101 of 2021)
.
101 of 2021)
.
The content of the announcement shows: According to the relevant provisions of the " Drug Administration Law of the People's Republic of China " and its implementation regulations, "Huanglian Shangqing Pills (Water Pills), Longdan Xiegan Pills (Water Pills), Fangfeng Tongsheng Pills (Water Pills) and Fenghan Cough Cough Pills ( Supplementary Inspection Method for Inspection Items of Rice-derived Ingredients in Water Pills" "Supplementary Inspection Method for Inspection Items of Aristolochic Acid I in Longdan Xiegan Pills" has been approved by the State Drug Administration and is hereby issued
.
.
Attachment: Supplementary inspection methods for inspection items
[Check] Rice-derived ingredients
Sample preparation Test sample preparation Take an appropriate amount of the test product, crush it, weigh out 10 g, add 50 ml of TE buffer solution (pH 8.
0) (10mmol/L Tris-HCl, 1mmol/L EDTA) preheated at 65°C, water bath at 65°C Shake to completely disperse, immediately pipet 0.
5ml of suspension into a 2ml centrifuge tube to get it
.
0) (10mmol/L Tris-HCl, 1mmol/L EDTA) preheated at 65°C, water bath at 65°C Shake to completely disperse, immediately pipet 0.
5ml of suspension into a 2ml centrifuge tube to get it
.
Standard material sample preparation Take 1 rice-derived DNA detection standard material, and dissolve it in 100 μl sterile ultrapure water to obtain it
.
.
Preparation of blank control sample Take 0.
5 ml of sterile TE buffer solution into a 2 ml centrifuge tube, and get it
.
5 ml of sterile TE buffer solution into a 2 ml centrifuge tube, and get it
.
Template DNA extraction Take the above-mentioned samples, and extract them with a plant genomic DNA extraction kit (spin column type) to obtain a template DNA solution, which is stored at -20°C for later use
.
.
PCR reaction identification primers: 5'TTAGCCTCCCGCTGCAGA3' and 5'AGAGTCCACAAGTGCTCCCG3'
.
PCR reaction system: carried out in a 200μl centrifuge tube, the total reaction volume is 25μl, the reaction system contains 2×PCR master mix (including DNA polymerase, dNTPs, MgCl2, reaction buffer, etc.
) 12.
5μl, identification primers (50μmol/L) 0.
2μl each, 2μl template DNA (or rice-derived DNA detection standard substance) solution, 10.
1μl sterile ultrapure water
.
Set 2 parallels for each sample
.
PCR reaction parameters: 95°C pre-denaturation for 3 minutes, 40 cycles of reaction (95°C for 30 seconds, 62°C for 30 seconds, 72°C for 30 seconds), 72°C extension for 10 minutes, and 4°C to store the reaction product
.
.
PCR reaction system: carried out in a 200μl centrifuge tube, the total reaction volume is 25μl, the reaction system contains 2×PCR master mix (including DNA polymerase, dNTPs, MgCl2, reaction buffer, etc.
) 12.
5μl, identification primers (50μmol/L) 0.
2μl each, 2μl template DNA (or rice-derived DNA detection standard substance) solution, 10.
1μl sterile ultrapure water
.
Set 2 parallels for each sample
.
PCR reaction parameters: 95°C pre-denaturation for 3 minutes, 40 cycles of reaction (95°C for 30 seconds, 62°C for 30 seconds, 72°C for 30 seconds), 72°C extension for 10 minutes, and 4°C to store the reaction product
.
Electrophoresis detection according to agarose gel electrophoresis method ("Chinese Pharmacopoeia" 2020 edition general rules 0541), the gel concentration is 2.
0%, the gel is added with the nucleic acid gel stain GelRed; test product, rice-derived DNA detection standard material and blank control The loading volume of the solution is 10-20μl, and the DNA molecular weight marker (DL500 is recommended) is 5μl
.
After the electrophoresis is over, take the gel piece and inspect it on the gel imager
.
0%, the gel is added with the nucleic acid gel stain GelRed; test product, rice-derived DNA detection standard material and blank control The loading volume of the solution is 10-20μl, and the DNA molecular weight marker (DL500 is recommended) is 5μl
.
After the electrophoresis is over, take the gel piece and inspect it on the gel imager
.
System applicability (1) Blank control should have no bands detected in the gel electrophoresis pattern ; (2) Rice-derived DNA detection standard materials should have bands detected in the gel electrophoresis pattern 50-100bp
.
The above two conditions should be met at the same time, otherwise the experiment will be invalid
.
.
The above two conditions should be met at the same time, otherwise the experiment will be invalid
.
For cloning and sequencing, commercial PCR product cloning kits were used to clone the PCR characteristic bands onto the T vector, use the Sanger method for sequence determination, and compare and analyze with the rice reference sequence
.
.
The result determined that in the gel electrophoresis pattern, the test product should not have a band the same size as the rice-derived DNA detection standard substance between 50 and 100 bp
.
If the corresponding band appears, the clone and sequencing result should be inconsistent with the given rice reference sequence
.
If there are individual base differences, compare the cloned sequencing results with other rice sequences in the NCBI database, and they should not match 100%
.
.
If the corresponding band appears, the clone and sequencing result should be inconsistent with the given rice reference sequence
.
If there are individual base differences, compare the cloned sequencing results with other rice sequences in the NCBI database, and they should not match 100%
.
Rice reference sequence
AGAGTCCACAAGTGCTCCCGCGCGTCC GAAGAAACCAACCACACTGCCGCTCTGCAGCGGGAGGCTAA
.
.
Remarks This method should be disposable containers or supplies, and washed thoroughly with high pressure sterilization and eliminates nucleic acid contamination of supplies, or can not be reused
.
The reagents are all analytical reagents or biochemical reagents, and the experimental water should meet the requirements of GB/T6682
.
All reagents are packed in containers that are not contaminated by DNase
.
.
The reagents are all analytical reagents or biochemical reagents, and the experimental water should meet the requirements of GB/T6682
.
All reagents are packed in containers that are not contaminated by DNase
.
Drafting unit: China Food and Drug Control Research Institute
Review unit: Sichuan Institute of Food and Drug Inspection
Medical Network, August 24 News On August 23, the State Food and Drug Administration issued an announcement on two supplementary inspection methods including the supplementary inspection methods for rice-derived ingredients in water pills such as Huanglian Shangqing Pills (No.
101 of 2021)
.
Medical Network News on August 24 101 of 2021)
.
The content of the announcement shows: According to the relevant provisions of the " Drug Administration Law of the People's Republic of China " and its implementation regulations, "Huanglian Shangqing Pills (Water Pills), Longdan Xiegan Pills (Water Pills), Fangfeng Tongsheng Pills (Water Pills) and Fenghan Cough Cough Pills ( Supplementary Inspection Method for Inspection Items of Rice-derived Ingredients in Water Pills" "Supplementary Inspection Method for Inspection Items of Aristolochic Acid I in Longdan Xiegan Pills" has been approved by the State Drug Administration and is hereby issued
.
Medicine, medicine, medicine.
Attachment: Supplementary inspection methods for inspection items
Attachment: Supplementary inspection methods for inspection items [Check] Rice-derived ingredients
[Check] Rice-derived ingredients Sample preparation Test sample preparation Take an appropriate amount of the test product, crush it, weigh out 10 g, add 50 ml of TE buffer solution (pH 8.
0) (10mmol/L Tris-HCl, 1mmol/L EDTA) preheated at 65°C, water bath at 65°C Shake to completely disperse, immediately pipet 0.
5ml of suspension into a 2ml centrifuge tube to get it
.
0) (10mmol/L Tris-HCl, 1mmol/L EDTA) preheated at 65°C, water bath at 65°C Shake to completely disperse, immediately pipet 0.
5ml of suspension into a 2ml centrifuge tube to get it
.
Standard material sample preparation Take 1 rice-derived DNA detection standard material, and dissolve it in 100 μl sterile ultrapure water to obtain it
.
Standard Standard Standard.
Preparation of blank control sample Take 0.
5 ml of sterile TE buffer solution into a 2 ml centrifuge tube, and get it
.
5 ml of sterile TE buffer solution into a 2 ml centrifuge tube, and get it
.
Template DNA extraction Take the above-mentioned samples, and extract them with a plant genomic DNA extraction kit (spin column type) to obtain a template DNA solution, which is stored at -20°C for later use
.
.
PCR reaction identification primers: 5'TTAGCCTCCCGCTGCAGA3' and 5'AGAGTCCACAAGTGCTCCCG3'
.
PCR reaction system: carried out in a 200μl centrifuge tube, the total reaction volume is 25μl, the reaction system contains 2×PCR master mix (including DNA polymerase, dNTPs, MgCl2, reaction buffer, etc.
) 12.
5μl, identification primers (50μmol/L) 0.
2μl each, 2μl template DNA (or rice-derived DNA detection standard substance) solution, 10.
1μl sterile ultrapure water
.
Set 2 parallels for each sample
.
PCR reaction parameters: 95°C pre-denaturation for 3 minutes, 40 cycles of reaction (95°C for 30 seconds, 62°C for 30 seconds, 72°C for 30 seconds), 72°C extension for 10 minutes, and 4°C to store the reaction product
.
.
PCR reaction system: carried out in a 200μl centrifuge tube, the total reaction volume is 25μl, the reaction system contains 2×PCR master mix (including DNA polymerase, dNTPs, MgCl2, reaction buffer, etc.
) 12.
5μl, identification primers (50μmol/L) 0.
2μl each, 2μl template DNA (or rice-derived DNA detection standard substance) solution, 10.
1μl sterile ultrapure water
.
Set 2 parallels for each sample
.
PCR reaction parameters: 95°C pre-denaturation for 3 minutes, 40 cycles of reaction (95°C for 30 seconds, 62°C for 30 seconds, 72°C for 30 seconds), 72°C extension for 10 minutes, and 4°C to store the reaction product
.
Electrophoresis detection according to agarose gel electrophoresis method ("Chinese Pharmacopoeia" 2020 edition general rules 0541), the gel concentration is 2.
0%, the gel is added with the nucleic acid gel stain GelRed; test product, rice-derived DNA detection standard material and blank control The loading volume of the solution is 10-20μl, and the DNA molecular weight marker (DL500 is recommended) is 5μl
.
After the electrophoresis is over, take the gel piece and inspect it on the gel imager
.
0%, the gel is added with the nucleic acid gel stain GelRed; test product, rice-derived DNA detection standard material and blank control The loading volume of the solution is 10-20μl, and the DNA molecular weight marker (DL500 is recommended) is 5μl
.
After the electrophoresis is over, take the gel piece and inspect it on the gel imager
.
System applicability (1) Blank control should have no bands detected in the gel electrophoresis pattern ; (2) Rice-derived DNA detection standard materials should have bands detected in the gel electrophoresis pattern 50-100bp
.
The above two conditions should be met at the same time, otherwise the experiment will be invalid
.
Atlas Atlas Atlas.
The above two conditions should be met at the same time, otherwise the experiment will be invalid
.
For cloning and sequencing, commercial PCR product cloning kits were used to clone the PCR characteristic bands onto the T vector, use the Sanger method for sequence determination, and compare and analyze with the rice reference sequence
.
.
The result determined that in the gel electrophoresis pattern, the test product should not have a band the same size as the rice-derived DNA detection standard substance between 50 and 100 bp
.
If the corresponding band appears, the clone and sequencing result should be inconsistent with the given rice reference sequence
.
If there are individual base differences, compare the cloned sequencing results with other rice sequences in the NCBI database, and they should not match 100%
.
.
If the corresponding band appears, the clone and sequencing result should be inconsistent with the given rice reference sequence
.
If there are individual base differences, compare the cloned sequencing results with other rice sequences in the NCBI database, and they should not match 100%
.
Rice reference sequence
Rice reference sequence AGAGTCCACAAGTGCTCCCGCGCGTCC GAAGAAACCAACCACACTGCCGCTCTGCAGCGGGAGGCTAA
.
.
Remarks This method should be disposable containers or supplies, and washed thoroughly with high pressure sterilization and eliminates nucleic acid contamination of supplies, or can not be reused
.
The reagents are all analytical reagents or biochemical reagents, and the experimental water should meet the requirements of GB/T6682
.
All reagents are packed in containers that are not contaminated by DNase
.
Disinfection disinfection disinfection.
The reagents are all analytical reagents or biochemical reagents, and the experimental water should meet the requirements of GB/T6682
.
All reagents are packed in containers that are not contaminated by DNase
.
Drafting unit: China Food and Drug Control Research Institute
Drafting unit: China Food and Drug Control Research Institute Review unit: Sichuan Institute of Food and Drug Inspection
Review unit: Sichuan Institute of Food and Drug Inspection 
