Yeast indica PCR method

Ask: very depressed, recently doing electro-turned-bi-chi yeast, but the conversion did not have a suitable screening method, if the genome is time-time-saving, and because my chances of this electricity transfer is very low, there is 1%-10%, so want to use the bacteria
PCR
, but yeast is difficult to break the wall, if not processed well, the genome can not be released, there is no positive results.
checked some information to say that with repeated freezing and melting method, is not directly single-bacterial on the line? Also said to use snail enzymes to help digestion, this I am not very clear, so please help the prawns, now is really this heart-wracking!
100,000 people are in a hurry to get help!!!!!!!
: Snail enzyme extraction
DNA
later PCR effect is very stable
yeast DNA extraction
1, x fresh bacteria added 150ul (200ul) bufferiI25 (30) ul snail enzyme (30mg/ml), 37 degrees, 10Min (can 30min water bath, interval 5 minutes, oscillation once, to avoid cell sinking to the bottom of the tube.
2, centrifuged 10000rmp, 10min, go to The Qing, precipitate to add buffer II250ul
3, add 25ul, 10%
SDS
. 65 degrees, 30min water bath.
4, add 25ul 5mol/lKAC, ice bath 60 minutes (4 degree refrigerator can be placed on it)
5, 12000rmp, 15min, take clear, add 2 in the upper Qing -3 times the volume of waterless ethanol, mixed and placed -20 degrees for an hour (can be overnight, do not oscillate after removal, direct centrifugation)
6, 12000rmp, 15min, discarded.
7, 150ul, buffer III solution precipitation, 12000rmp, 15min
8, transfer the upper solution to a clean centrifuge tube, add 6ul (10ug/ul), ranase , 37 degrees, 30min
9, added isopropyl alcohol, 4 degrees still 10min, 10000rmp, 5min, dissolved in 50ulbuffer III
10, if any
protein
can be drawn using phenolic chloroform
11, bufferI:0.9mol/l sorbitol, 0.1mol/l
EDTA
12, bufferII:50m Mol/l Tris, 20mmol/l EDTA
13, bufferIII:10mmol/l tris, 1mol/l EDTA
14, screening AD/BD can be used directly
antibiotic
screening methods
Yeast fall PCR
1, preparation of yeast granules and genomic DNA PCR templates
take 1.5ml, 13000 x years of yeast strains r/min, centrifugal 15s, go to the top clear, double steamed water wash once, 13000r/min centrifugal 15s, precipitated suspended in 200ulTE buffer, boiled on boiling water 1-10min, ice bath 10min, 13000r/min, centrifugal 5min, store the liquid at -20 degrees to take 1ul for PCR
2, raise from the tablet to take a little good-growing bacterios, suspended in 20ul sterile Water 0.5 ml eppendofff centrifugal tube (the center of the centrifuge is pre-injected with a syringe needle to tie a small hole, place the lid due to thermal expansion) water bath boiling 0.2.5.10min
3, Rapid preparation of yeast treatment and fungi in the microwave oven to take more than 3mm diameter yeast dry bacteria, as to the EP tube cover, in the microwave oven
heat
, add 30ulTE oscillation, 13000r/min, centrifugal 2-5min, storage bath -20 degrees, take 1ul for PCR
fungal DNA extraction method Improved
1, yeast resusced and then added YEPD
culture
-base, 25-28 degree culture 16-24 hours, collecting bacteria
2, take a little fresh bacteria, add 0.6 ml buffer I (0.9mol/l sorbitol, 0.1mol/l EDTA) 1 ml. 0.1ml snail enzyme (30mg/ml), 37 degrees warm bath 60min
3, 3000r/min centrifugation 10s, go to the clear, precipitation added to the buffer II150mmol/l Tris, 20mmol/l EDTA 1ml 10% SDS0.1ml 65 degrees, 30min water bath.
4, add 0.3ml, 5mol/lKAC ice bath 60 minutes
5, 10000rmp, 15min, take clear, add 2-3 times the volume of waterless ethanol in the upper clear, mix and place -20 degrees an hour (overnight, do not oscillate after removal, direct centrifugation) at 5000-6000r/min centrifugation 15s
6, precipitation with 0.6 ml buffer III10mmol/l tris , 1mol/l EDTA dissolves 1000r/min, centrifugal 15min
7, upper liquid transfer in a clean centrifuge tube, add 6ul10ug/ul), ranase, 37 degrees, 30min
8, add isopropyl alcohol, 4 degrees still 10min, 10000rmp, 5min, dissolved in 50ulbuffer III
9, if there is a protein can use phenolic chloroform pumping
follow-up test ideas
1, Extraction of yeast DNA
2, PCR
3, sieve lead (upper CTATTCGATGATATACCCCACCACCAACCC
: GTGAACTTCGGGGGTTTTTTAGTATCTACGATT
because the TM value of this quote is very high, it is necessary to use secondary PCR
94 degrees, 3min, 95 degrees, 20miao, 68 degrees 3min, 68 degrees 7min, 15 degrees 1 5min
program 94 degrees, 3min, 95 degrees, 25miao, 50 degrees 25miao, 72 degrees 1min30s, 72 degrees 5min
4, using T and B enzymes Cut (65 degree enzyme cut)
Taq I (AGCT)
10*Taq I Basal buffer
0.1% bsa
PCR product
sterilized water
enzyme
BsuRI (GGCC)
buffer R buffer
template
sterilized water
enzyme
5, divided into different pieces
6, transferred DNA to E. coli, and then extracted protons, sequencing or using antibiotics to screen AMP, get AD, kana get BD